Stem-loop sequence dse-mir-124

Accession MI0009402
Description Drosophila sechellia miR-124 stem-loop
Gene family MIPF0000021; mir-124
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-124_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-124 microRNA precursor is a small non-coding RNA molecule that has been identified in flies (MI0000373), nematode worms (MI0000302), mouse (MI0000150) and human (MI0000443). The mature ~21 nucleotide microRNAs are processed from hairpin precursor sequences by the Dicer enzyme, and in this case originates from the 3' arm. miR-124 has been found to be the most abundant microRNA expressed in neuronal cells. Experiments to alter expression of miR-124 in neural cells did not appear to affect differentiation.. However the topic result quite controversial since different reports described also a role for miR-124 during neuronal differentiation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
ua     uu   c      c      ag    a    uau 
  cguuu  cuc ugguau cacugu  gccu uaug   u
  |||||  ||| |||||| ||||||  |||| ||||   u
  gcaag  gag accgua guggcg  cgga auac   c
ac     -c   a      a      ca    -    cac 
Get sequence
Genome context
Coordinates (dsec_r1.3_FB2010_02) Overlapping transcripts
scaffold_7: 1207328-1207408 [+]
intergenic
Clustered miRNAs
< 10kb from dse-mir-124
dse-mir-124 scaffold_7: 1207328-1207408 [+]
dse-mir-287 scaffold_7: 1215470-1215540 [+]

Mature sequence dse-miR-124

Accession MIMAT0008839
Sequence

49 - 

uaaggcacgcggugaaugccaag

 - 71

Get sequence
Evidence by similarity; MI0000373

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).