Stem-loop sequence dse-mir-4

AccessionMI0009398 (change log)
DescriptionDrosophila sechellia miR-4 stem-loop
Gene family MIPF0000305; mir-4
Stem-loop
    ug    u gu   uu    c   c   cuuag    - uu 
5' u  caau a  uuc  uggu guc agc     guga c  u
   |  |||| |  |||  |||| ||| |||     |||| |   
3' g  guug u  aag  acca cag ucg     uacu g  u
    gu    c ug   uu    a   a   --aaa    a cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsec_r1.3_FB2010_02) Overlapping transcripts
scaffold_1: 13063523-13063603 [-]
intergenic
Clustered miRNAs
< 10kb from dse-mir-4
dse-mir-309scaffold_1: 13063938-13064006 [-]
dse-mir-3scaffold_1: 13063827-13063895 [-]
dse-mir-286scaffold_1: 13063657-13063755 [-]
dse-mir-4scaffold_1: 13063523-13063603 [-]
dse-mir-5scaffold_1: 13063395-13063458 [-]
dse-mir-6-1scaffold_1: 13063246-13063316 [-]
dse-mir-6-2scaffold_1: 13063107-13063180 [-]
dse-mir-6-3scaffold_1: 13062954-13063033 [-]
Database links

Mature sequence dse-miR-4

Accession MIMAT0008835
Sequence

49 - 

auaaagcuagacaaccauuga

 - 69

Get sequence
Evidence by similarity; MI0000122

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).