Stem-loop sequence dse-mir-5

AccessionMI0009391 (change log)
DescriptionDrosophila sechellia miR-5 stem-loop
Gene family MIPF0000309; mir-5
Stem-loop
   --ua       c               ag   u 
5'     aaaggaa gaucguugugauaug  uug u
       ||||||| |||||||||||||||  |||  
3'     uuuccuu uuagugacacuauac  agc c
   aaua       -               -a   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsec_r1.3_FB2010_02) Overlapping transcripts
scaffold_1: 13063395-13063458 [-]
intergenic
Clustered miRNAs
< 10kb from dse-mir-5
dse-mir-309scaffold_1: 13063938-13064006 [-]
dse-mir-3scaffold_1: 13063827-13063895 [-]
dse-mir-286scaffold_1: 13063657-13063755 [-]
dse-mir-4scaffold_1: 13063523-13063603 [-]
dse-mir-5scaffold_1: 13063395-13063458 [-]
dse-mir-6-1scaffold_1: 13063246-13063316 [-]
dse-mir-6-2scaffold_1: 13063107-13063180 [-]
dse-mir-6-3scaffold_1: 13062954-13063033 [-]
Database links

Mature sequence dse-miR-5

Accession MIMAT0008829
Sequence

3 - 

aaaggaacgaucguugugauaug

 - 25

Get sequence
Evidence by similarity; MI0000123

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).