Stem-loop sequence dse-mir-31b

AccessionMI0009385 (change log)
DescriptionDrosophila sechellia miR-31b stem-loop
Gene family MIPF0000064; mir-31
Stem-loop
       -     aau     a     uc  a       agagcacagcggaucgagccucuuauc 
5' caaa uaaug   uuggc agaug  gg auagcug                           g
   |||| |||||   ||||| |||||  || |||||||                           u
3' guuu auuac   aacug ucuac  cc uaucggc                           c
       c     guu     a     -u  g       gaaaaguuuuuauuaguguaaaaaagc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsec_r1.3_FB2010_02) Overlapping transcripts
scaffold_34: 250184-250310 [-]
intergenic
Database links

Mature sequence dse-miR-31b

Accession MIMAT0008823
Sequence

14 - 

uggcaagaugucggaauagcug

 - 35

Get sequence
Evidence by similarity; MI0000410

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).