Stem-loop sequence dse-mir-275

AccessionMI0009383 (change log)
DescriptionDrosophila sechellia miR-275 stem-loop
Gene family MIPF0000187; mir-275
Stem-loop
   aa    c     u         -a    ug   gg    u  uuu 
5'   gucu cuacc ugcgcgcua  ucag  acc  ggcu gu   u
     |||| ||||| |||||||||  ||||  |||  |||| ||   u
3'   caga ggugg gcgcgcgau  aguc  ugg  cuga ca   a
   ua    c     u         ga    ca   -a    -  uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsec_r1.3_FB2010_02) Overlapping transcripts
scaffold_3: 2941259-2941348 [+]
intergenic
Clustered miRNAs
< 10kb from dse-mir-275
dse-mir-275scaffold_3: 2941259-2941348 [+]
dse-mir-305scaffold_3: 2941433-2941505 [+]
Database links

Mature sequence dse-miR-275

Accession MIMAT0008820
Sequence

55 - 

ucagguaccugaaguagcgcgcg

 - 77

Get sequence
Evidence by similarity; MI0000356

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).