Stem-loop sequence dse-mir-13b-1

AccessionMI0009380 (change log)
DescriptionDrosophila sechellia miR-13b-1 stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
      -ug           u      acu    uauu 
5' cca   ucguuaaaaug uuguga   uaug    c
   |||   ||||||||||| ||||||   ||||     
3' ggu   agcaguuuuac gacacu   auac    g
      uug           c      ---    uaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsec_r1.3_FB2010_02) Overlapping transcripts
scaffold_0: 10705205-10705272 [+]
intergenic
Clustered miRNAs
< 10kb from dse-mir-13b-1
dse-mir-2cscaffold_0: 10704844-10704945 [+]
dse-mir-13ascaffold_0: 10705068-10705142 [+]
dse-mir-13b-1scaffold_0: 10705205-10705272 [+]
Database links

Mature sequence dse-miR-13b

Accession MIMAT0008816
Sequence

43 - 

uaucacagccauuuugacgagu

 - 64

Get sequence
Evidence by similarity; MI0000134

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).