Stem-loop sequence dse-mir-1

AccessionMI0009376 (change log)
DescriptionDrosophila sechellia miR-1 stem-loop
Gene family MIPF0000038; mir-1
Stem-loop
   ca   uuu  --ga            c        a   -   au 
5'   gcc   ga    guuccaugcuuc uugcauuc aua guu  a
     |||   ||    |||||||||||| |||||||| ||| |||  c
3'   cgg   cu    cgagguaugaag aauguaag uau cga  u
   ag   --u  aaag            a        g   a   ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsec_r1.3_FB2010_02) Overlapping transcripts
scaffold_18: 365668-365755 [+]
intergenic
Database links

Mature sequence dse-miR-1

Accession MIMAT0008814
Sequence

54 - 

uggaauguaaagaaguauggag

 - 75

Get sequence
Evidence by similarity; MI0000116

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).