Stem-loop sequence dse-mir-288

AccessionMI0009368 (change log)
DescriptionDrosophila sechellia miR-288 stem-loop
Gene family MIPF0000223; mir-288
Stem-loop
        a      aauuagcg   ca      --u       auaauuaa    g 
5' cgguc ugucgu        gag  cggcau   gccggcg        ugac g
   ||||| ||||||        |||  ||||||   |||||||        ||||  
3' gccgg acagua        cuu  gcugua   ugguugc        acug u
        c      ---cuuua   ua      cuu       --------    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsec_r1.3_FB2010_02) Overlapping transcripts
scaffold_18: 498552-498648 [-]
intergenic
Clustered miRNAs
< 10kb from dse-mir-288
dse-mir-288scaffold_18: 498552-498648 [-]
dse-mir-133scaffold_18: 496883-496973 [+]
Database links

Mature sequence dse-miR-288

Accession MIMAT0008806
Sequence

66 - 

uuucaugucgauuucauuucaug

 - 88

Get sequence
Evidence by similarity; MI0000384

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).