Stem-loop sequence dse-mir-306

AccessionMI0009367 (change log)
DescriptionDrosophila sechellia miR-306 stem-loop
Gene family MIPF0000313; mir-306
Stem-loop
   --      c au   u       uu            ugccu 
5'   uccacu g  ggc cagguac  agugacucucaa     u
     |||||| |  ||| |||||||  ||||||||||||     u
3'   ggguga c  ucg guccgug  ucacuggggguu     g
   ca      - cg   u       uc            uuaca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsec_r1.3_FB2010_02) Overlapping transcripts
scaffold_7: 345422-345505 [+]
intergenic
Clustered miRNAs
< 10kb from dse-mir-306
dse-mir-9cscaffold_7: 344907-344998 [+]
dse-mir-306scaffold_7: 345422-345505 [+]
dse-mir-79scaffold_7: 345568-345659 [+]
dse-mir-9bscaffold_7: 345756-345844 [+]
Database links

Mature sequence dse-miR-306-5p

Accession MIMAT0008804
Previous IDsdse-miR-306
Sequence

14 - 

ucagguacuuagugacucucaa

 - 35

Get sequence
Evidence by similarity; MI0000414

Mature sequence dse-miR-306-3p

Accession MIMAT0008805
Previous IDsdse-miR-306*
Sequence

51 - 

gggggucacucugugccugugc

 - 72

Get sequence
Evidence by similarity; MI0000414

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).