Stem-loop sequence dse-mir-309

AccessionMI0009366 (change log)
DescriptionDrosophila sechellia miR-309 stem-loop
Gene family MIPF0000140; mir-3
Stem-loop
         c       c   uu    u   c aau 
5' auuaua gacaaac uug  cggu uug c   u
   |||||| ||||||| |||  |||| ||| |   u
3' uaauau cuguuug aau  guca gac g   c
         c       a   gg    c   c aac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsec_r1.3_FB2010_02) Overlapping transcripts
scaffold_1: 13063938-13064006 [-]
intergenic
Clustered miRNAs
< 10kb from dse-mir-309
dse-mir-309scaffold_1: 13063938-13064006 [-]
dse-mir-3scaffold_1: 13063827-13063895 [-]
dse-mir-286scaffold_1: 13063657-13063755 [-]
dse-mir-4scaffold_1: 13063523-13063603 [-]
dse-mir-5scaffold_1: 13063395-13063458 [-]
dse-mir-6-1scaffold_1: 13063246-13063316 [-]
dse-mir-6-2scaffold_1: 13063107-13063180 [-]
dse-mir-6-3scaffold_1: 13062954-13063033 [-]
Database links

Mature sequence dse-miR-309

Accession MIMAT0008803
Sequence

44 - 

gcacuggguaaaguuuguccua

 - 65

Get sequence
Evidence by similarity; MI0000421

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).