Stem-loop sequence dse-mir-9a

AccessionMI0009362 (change log)
DescriptionDrosophila sechellia miR-9a stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
       -     u       uau      g     -  gau 
5' gcua uguug cuuuggu   cuagcu uauga gu   a
   |||| ||||| |||||||   |||||| ||||| ||    
3' cgau auaau gaagcca   gaucga auacu ca   a
       u     u       uuc      a     g  aua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsec_r1.3_FB2010_02) Overlapping transcripts
scaffold_29: 261384-261461 [+]
intergenic
Database links

Mature sequence dse-miR-9a

Accession MIMAT0008800
Sequence

10 - 

ucuuugguuaucuagcuguauga

 - 32

Get sequence
Evidence by similarity; MI0000129

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).