Stem-loop sequence dse-mir-277

AccessionMI0009356 (change log)
DescriptionDrosophila sechellia miR-277 stem-loop
Gene family MIPF0000156; mir-277
Stem-loop
   --   a g       gc  -   gu    -            c  aaa u 
5'   uug a guuuugg  ug cgu  cagg agugcauuugca ug   c a
     ||| | |||||||  || |||  |||| |||||||||||| ||   | u
3'   aac u caagacc  ac gca  gucu ucacguaaaugu ac   g c
   cu   a g       uu  a   ug    a            -  gaa u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsec_r1.3_FB2010_02) Overlapping transcripts
scaffold_0: 15987794-15987891 [-]
intergenic
Clustered miRNAs
< 10kb from dse-mir-277
dse-mir-317scaffold_0: 15996588-15996679 [-]
dse-mir-9685scaffold_0: 15993641-15993696 [-]
dse-mir-277scaffold_0: 15987794-15987891 [-]
dse-mir-34scaffold_0: 15986848-15986943 [-]
Database links

Mature sequence dse-miR-277

Accession MIMAT0008794
Sequence

59 - 

uaaaugcacuaucugguacgaca

 - 81

Get sequence
Evidence by similarity; MI0000360

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).