Stem-loop sequence dse-mir-317

AccessionMI0009351 (change log)
DescriptionDrosophila sechellia miR-317 stem-loop
Gene family MIPF0000144; mir-317
Stem-loop
       --a  u         aua    --     c      u aa  a 
5' augc   ac gccauuggg   cacc  cugug ucgcuu g  ug a
   ||||   || |||||||||   ||||  ||||| |||||| |  || a
3' uacg   ug cggugaccu   gugg  gacac agugaa c  ac u
       guu  c         aug    uc     a      - ga  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsec_r1.3_FB2010_02) Overlapping transcripts
scaffold_0: 15996588-15996679 [-]
intergenic
Clustered miRNAs
< 10kb from dse-mir-317
dse-mir-317scaffold_0: 15996588-15996679 [-]
dse-mir-9685scaffold_0: 15993641-15993696 [-]
dse-mir-277scaffold_0: 15987794-15987891 [-]
dse-mir-34scaffold_0: 15986848-15986943 [-]
Database links

Mature sequence dse-miR-317

Accession MIMAT0008789
Sequence

56 - 

ugaacacagcuggugguauccagu

 - 79

Get sequence
Evidence by similarity; MI0000429

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).