Stem-loop sequence dse-mir-34

Accession MI0009349
Description Drosophila sechellia miR-34 stem-loop
Gene family MIPF0000039; mir-34
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-34_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-34 microRNA precursor family are non-coding RNA molecules that, in mammals, give rise to three major mature miRNAs. The miR-34 family members were discovered computationally and later verified experimentally. The precursor miRNA stem-loop is processed in the cytoplasm of the cell, with the predominant miR-34 mature sequence excised from the 5' arm of the hairpin. The mature miR-34a is a part of the p53 tumor suppressor network of proteins; therefore, it is hypothesized that miR-34 dysregulation is involved in the development of some cancers.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
ug   a  -   uu        u  u   c        --ua c    ua 
  gcu ug cgc  uggcagug gg uag ugguugug    g caau  u
  ||| || |||  |||||||| || ||| ||||||||    | ||||  u
  cga ac gcg  gccgucac uc auc accgacac    c guug  g
--   -  a   cc        u  u   -        uuaa a    cc 
Get sequence
Genome context
Coordinates (dsec_r1.3_FB2010_02) Overlapping transcripts
scaffold_0: 15986848-15986943 [-]
intergenic
Clustered miRNAs
< 10kb from dse-mir-34
dse-mir-317 scaffold_0: 15996588-15996679 [-]
dse-mir-277 scaffold_0: 15987794-15987891 [-]
dse-mir-34 scaffold_0: 15986848-15986943 [-]

Mature sequence dse-miR-34

Accession MIMAT0008787
Sequence

14 - 

uggcagugugguuagcugguug

 - 35

Get sequence
Evidence by similarity; MI0000371

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).