Stem-loop sequence dse-mir-13a

AccessionMI0009348 (change log)
DescriptionDrosophila sechellia miR-13a stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
       u     c      -        a   --uc  cu 
5' uacg aacuc ucaaag gguuguga aug    ga  a
   |||| ||||| |||||| |||||||| |||    ||   
3' gugc uugag aguuuu ccgacacu uac    cu  u
       u     u      a        a   ucau  au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsec_r1.3_FB2010_02) Overlapping transcripts
scaffold_0: 10705068-10705142 [+]
intergenic
Clustered miRNAs
< 10kb from dse-mir-13a
dse-mir-2cscaffold_0: 10704844-10704945 [+]
dse-mir-13ascaffold_0: 10705068-10705142 [+]
dse-mir-13b-1scaffold_0: 10705205-10705272 [+]
Database links

Mature sequence dse-miR-13a

Accession MIMAT0008786
Sequence

48 - 

uaucacagccauuuugaugagu

 - 69

Get sequence
Evidence by similarity; MI0000133

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).