Stem-loop sequence dse-mir-10

AccessionMI0009346 (change log)
DescriptionDrosophila sechellia miR-10 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
        ucu   -  g    u             auacu 
5' ccacg   acc cu uaga ccgaauuuguuuu     a
   |||||   ||| || |||| |||||||||||||      
3' ggugu   ugg ga aucu ggcuuaaacagga     g
        guu   a  g    u             auuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsec_r1.3_FB2010_02) Overlapping transcripts
scaffold_6: 2726449-2726525 [-]
intergenic
Database links

Mature sequence dse-miR-10

Accession MIMAT0008784
Sequence

9 - 

acccuguagauccgaauuugu

 - 29

Get sequence
Evidence by similarity; MI0000130

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).