Stem-loop sequence dpe-mir-92a

AccessionMI0009325 (change log)
DescriptionDrosophila persimilis miR-92a stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   ua   a           a     -     u   c    uacau 
5'   gag uugcccguagg cggga aggug caa guuu     u
     ||| ||||||||||| ||||| ||||| ||| ||||      
3'   uuc ggcggguaucc gcccu uucac guu caaa     u
   ug   -           g     g     -   a    caagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dper_r1.3_FB2010_02) Overlapping transcripts
scaffold_3: 6410324-6410408 [-]
intergenic
Clustered miRNAs
< 10kb from dpe-mir-92a
dpe-mir-92ascaffold_3: 6410324-6410408 [-]
dpe-mir-92bscaffold_3: 6405664-6405754 [-]
Database links

Mature sequence dpe-miR-92a

Accession MIMAT0008763
Sequence

53 - 

cauugcacuugucccggccuau

 - 74

Get sequence
Evidence by similarity; MI0000357

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).