Stem-loop sequence dpe-mir-288

AccessionMI0009310 (change log)
DescriptionDrosophila persimilis miR-288 stem-loop
Gene family MIPF0000223; mir-288
Stem-loop
   -    a      -------   ua   -   ua      u       aaaa 
5'  ggcc ugucgu       aau  gca ggg  cagcgu gccggcg    u
    |||| ||||||       |||  ||| |||  |||||| |||||||    u
3'  ccgg acagua       uua  ugu cuu  guugca ugguugc    a
   g    c      cuuuacu   gc   a   ug      c       agua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dper_r1.3_FB2010_02) Overlapping transcripts
scaffold_1: 9142380-9142475 [+]
intergenic
Clustered miRNAs
< 10kb from dpe-mir-288
dpe-mir-288scaffold_1: 9142380-9142475 [+]
dpe-mir-133scaffold_1: 9145735-9145824 [-]
Database links

Mature sequence dpe-miR-288

Accession MIMAT0008753
Sequence

65 - 

uuucaugucgauuucauuucaug

 - 87

Get sequence
Evidence by similarity; MI0000384

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).