Stem-loop sequence dpe-mir-31b

AccessionMI0009309 (change log)
DescriptionDrosophila persimilis miR-31b stem-loop
Gene family MIPF0000064; mir-31
Stem-loop
   -au     a     uc  a       -agag    aaga 
5'    uuggc agaug  gg auagcug     caaa    a
      ||||| |||||  || |||||||     ||||     
3'    aacug ucuac  cc uaucggc     guuu    g
   guu     a     -u  g       guaaa    agua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dper_r1.3_FB2010_02) Overlapping transcripts
scaffold_13: 404334-404410 [+]
intergenic
Database links

Mature sequence dpe-miR-31b

Accession MIMAT0008752
Sequence

4 - 

uggcaagaugucggaauagcuga

 - 26

Get sequence
Evidence by similarity; MI0000420

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).