Stem-loop sequence dpe-mir-289

AccessionMI0009305 (change log)
DescriptionDrosophila persimilis miR-289 stem-loop
Gene family MIPF0000222; mir-289
Stem-loop
   ag     a   -a      ua         ---     ----- c  -    g 
5'   uuuac gug  aauaaa  uuuaagugg   agccu     g ga cugg a
     ||||| |||  ||||||  |||||||||   |||||     | || ||||  
3'   aaaug cac  uuguuu  gaguucacu   ucggg     c cu gacc c
   ga     -   gg      gc         caa     ucagc u  c    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dper_r1.3_FB2010_02) Overlapping transcripts
scaffold_36: 488162-488258 [+]
intergenic
Database links

Mature sequence dpe-miR-289

Accession MIMAT0008748
Sequence

15 - 

uaaauauuuaaguggagccugcgacu

 - 40

Get sequence
Evidence by similarity; MI0000385

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).