Stem-loop sequence dpe-mir-317-1

AccessionMI0009302 (change log)
DescriptionDrosophila persimilis miR-317-1 stem-loop
Gene family MIPF0000144; mir-317
Stem-loop
   u   --  u         aua    --     c      ugaauau 
5'  gca  ac gccguuggg   cacc  cugug ucgcuu       g
    |||  || |||||||||   ||||  ||||| ||||||        
3'  cgu  ug cgguaaccu   gugg  gacac agugaa       g
   a   cu  c         aug    uc     a      cgaacgu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dper_r1.3_FB2010_02) Overlapping transcripts
scaffold_19: 735514-735603 [-]
intergenic
Clustered miRNAs
< 10kb from dpe-mir-317-1
dpe-mir-317-1scaffold_19: 735514-735603 [-]
dpe-mir-277scaffold_19: 726038-726135 [-]
Database links

Mature sequence dpe-miR-317

Accession MIMAT0008739
Sequence

55 - 

ugaacacagcuggugguauccaau

 - 78

Get sequence
Evidence by similarity; MI0000429

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).