Stem-loop sequence dpe-mir-125-1

AccessionMI0009286 (change log)
DescriptionDrosophila persimilis miR-125-1 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
        gu    au      augg ug  uc  u    c cu         cu  ua 
5' gacau  gcaa  guuugu    c  au  cc gaga c  aacuuguga  uu  a
   |||||  ||||  ||||||    |  ||  || |||| |  |||||||||  ||  u
3' uugua  cguu  caaacg    g  ua  gg cucu g  uugaacacu  ga  a
        gu    --      --ca gu  -u  c    a uu         uu  cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dper_r1.3_FB2010_02) Overlapping transcripts
scaffold_1: 5116595-5116704 [+]
intergenic
Clustered miRNAs
< 10kb from dpe-mir-125-1
dpe-mir-100-1scaffold_1: 5115324-5115405 [+]
dpe-let-7-1scaffold_1: 5116234-5116310 [+]
dpe-mir-125-1scaffold_1: 5116595-5116704 [+]
dpe-mir-125-2scaffold_1: 5117116-5117225 [+]
Database links

Mature sequence dpe-miR-125

Accession MIMAT0008725
Sequence

29 - 

ucccugagacccuaacuuguga

 - 50

Get sequence
Evidence by similarity; MI0000417

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).