Stem-loop sequence dpe-mir-281-1

AccessionMI0009281 (change log)
DescriptionDrosophila persimilis miR-281-1 stem-loop
Gene family MIPF0000087; mir-46
Stem-loop
         gg  a           -ug     c      caacgua 
5' cgaaua  ug auaaagagagc   uccgu gacagu       c
   ||||||  || |||||||||||   ||||| ||||||       c
3' gcuuau  au uguuucucucg   aggua cuguca       a
         -a  a           uua     -      uaauuua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dper_r1.3_FB2010_02) Overlapping transcripts
scaffold_2: 605321-605408 [-]
intergenic
Clustered miRNAs
< 10kb from dpe-mir-281-1
dpe-mir-281-1scaffold_2: 605321-605408 [-]
dpe-mir-281-2scaffold_2: 605117-605207 [-]
Database links

Mature sequence dpe-miR-281-1-5p

Accession MIMAT0008727
Previous IDsdpe-miR-281-1*
Sequence

15 - 

aagagagcuguccgucgacagu

 - 36

Get sequence
Evidence by similarity; MI0000366

Mature sequence dpe-miR-281-3p

Accession MIMAT0008728
Previous IDsdpe-miR-281
Sequence

56 - 

ugucauggaauugcucucuuugu

 - 78

Get sequence
Evidence by similarity; MI0000370

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).