Stem-loop sequence dpe-mir-100-2

AccessionMI0009272 (change log)
DescriptionDrosophila persimilis miR-100-2 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   -c    a     aa        u   aa      - u uuu 
5'   cauu acaga  cccguaau ccg  cuugug c g   u
     |||| |||||  |||||||| |||  |||||| | |    
3'   guaa ugucu  ggguauua ggc  gaacau g c   a
   ac    c     ga        c   ca      u u uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dper_r1.3_FB2010_02) Overlapping transcripts
scaffold_2335: 1258-1339 [+]
intergenic
Clustered miRNAs
< 10kb from dpe-mir-100-2
dpe-mir-100-2scaffold_2335: 1258-1339 [+]
dpe-let-7-2scaffold_2335: 2160-2236 [+]
dpe-mir-125-3scaffold_2335: 2521-2630 [+]
Database links

Mature sequence dpe-miR-100

Accession MIMAT0008718
Sequence

12 - 

aacccguaauuccgaacuugug

 - 33

Get sequence
Evidence by similarity; MI0000378

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).