Stem-loop sequence dpe-mir-133

Accession MI0009266
Description Drosophila persimilis miR-133 stem-loop
Gene family MIPF0000029; mir-133
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-133_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

mir-133 is a type of non-coding RNA called a microRNA that was first experimentally characterised in mice. Homologues have since been discovered in several other species including invertebrates such as the fruitfly Drosophila melanogaster. Each species often encodes multiple microRNAs with identical or similar mature sequence. For example, in the human genome there are three known miR-133 genes: miR-133a-1, miR-133a-2 and miR-133b found on chromosomes 18, 20 and 6 respectively. The mature sequence is excised from the 3' arm of the hairpin. miR-133 is expressed in muscle tissue and appears to repress the expression of non-muscle genes.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
ua    g    u              cauc  gu     -  auu 
  caac gcug auguagcugguuga    gg  cagau cu   u
  |||| |||| ||||||||||||||    ||  ||||| ||   u
  guug ugac uaugucgaccaacu    cc  guuua ga   a
ua    g    -              -ucc  ug     u  acu 
Get sequence
Genome context
Coordinates (dper_r1.3_FB2010_02) Overlapping transcripts
scaffold_1: 9145735-9145824 [-]
intergenic
Clustered miRNAs
< 10kb from dpe-mir-133
dpe-mir-133 scaffold_1: 9145735-9145824 [-]
dpe-mir-288 scaffold_1: 9142380-9142475 [+]

Mature sequence dpe-miR-133

Accession MIMAT0008712
Sequence

56 - 

uugguccccuucaaccagcugu

 - 77

Get sequence
Evidence by similarity; MI0000362

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).