Stem-loop sequence dpe-mir-6-3

AccessionMI0009261 (change log)
DescriptionDrosophila persimilis miR-6-3 stem-loop
Gene family MIPF0000119; mir-6
Stem-loop
   cc     c       c  ug   c       uuauccacc  u 
5'   aaccg agggaac gc  cug ugauaua         ca c
     ||||| ||||||| ||  ||| |||||||         ||  
3'   uuggu uuucuug cg  gac acuauau         gu u
   --     u       u  gu   -       --cuuuaca  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dper_r1.3_FB2010_02) Overlapping transcripts
scaffold_2: 8906643-8906725 [+]
intergenic
Clustered miRNAs
< 10kb from dpe-mir-6-3
dpe-mir-309scaffold_2: 8905710-8905777 [+]
dpe-mir-3scaffold_2: 8905839-8905911 [+]
dpe-mir-286scaffold_2: 8905981-8906076 [+]
dpe-mir-4scaffold_2: 8906168-8906248 [+]
dpe-mir-5scaffold_2: 8906361-8906432 [+]
dpe-mir-6-1scaffold_2: 8906500-8906568 [+]
dpe-mir-6-3scaffold_2: 8906643-8906725 [+]
dpe-mir-6-2scaffold_2: 8906789-8906868 [+]
Database links

Mature sequence dpe-miR-6

Accession MIMAT0008707
Sequence

58 - 

uaucacaguggcuguucuuuuu

 - 79

Get sequence
Evidence by similarity; MI0000126

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).