Stem-loop sequence dpe-mir-14

AccessionMI0009257 (change log)
DescriptionDrosophila persimilis miR-14 stem-loop
Gene family MIPF0000182; mir-14
Stem-loop
           c    cg      c    -ug u 
5' ugugggag gaga  gggacu acug   c u
   |||||||| ||||  |||||| ||||   |  
3' auauccuc cucu  uucuga ugau   g u
           u    uu      c    gaa u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dper_r1.3_FB2010_02) Overlapping transcripts
scaffold_4: 878763-878825 [-]
intergenic
Database links

Mature sequence dpe-miR-14

Accession MIMAT0008703
Sequence

41 - 

ucagucuuuuucucucuccua

 - 61

Get sequence
Evidence by similarity; MI0000136

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).