miRNA Entry for MI0009255

Description

Drosophila persimilis miR-184 stem-loop

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-184. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-184 microRNA is a short non-coding RNA molecule. MicroRNAs (miRNAs) function as posttranscriptional regulators of expression levels of other genes by several mechanisms. Several targets for miR-184 have been described, including that of mediators of neurological development, apoptosis and it has been suggested that miR-184 plays an essential role in development. MicroRNAs can bind to the three prime untranslated region (3’UTR) of the target messenger RNA (mRNA). Binding of the miRNA can hinder translation of mRNA by promoting degradation or inducing deadenylation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry

mir-184

miR-184 microRNA secondary structure and sequence conservation
Identifiers
Symbol	mir-184
Rfam	RF00657
miRBase family	MIPF0000059
Entrez	406960
HUGO	31555
OMIM	613146
Other data
RNA type	microRNA
Domain(s)	Eukaryota; Chordata

In molecular biology, miR-184 microRNA is a short non-coding RNA molecule. MicroRNAs (miRNAs) function as posttranscriptional regulators of expression levels of other genes by several mechanisms.^[1] Several targets for miR-184 have been described, including that of mediators of neurological development, apoptosis and it has been suggested that miR-184 plays an essential role in development.^[2]

MicroRNAs can bind to the three prime untranslated region (3’UTR) of the target messenger RNA (mRNA).^[3] Binding of the miRNA can hinder translation of mRNA by promoting degradation or inducing deadenylation.^[4]

Genomic location [edit]

miR-184 is a single copy gene and evolutionarily conserved at the nucleotide level from flies to humans.^[5] In humans, miR-184 is located within region 25.1 on the q-arm of chromosome 15, and its corresponding transcript is comparatively small (84bp) which is not encoded near other clustered miRNAs.^[6] In the mouse genome, miR-184 is located in an imprinted locus on mouse chromosome 9, and it is 55 kb away from the nearest coding gene.^[7]

The genomic region immediately surrounding miR-184 does not contain a classic CpG island, but does contain several CpG-rich sequences that are suitable for MBD1 binding.^[8]

Expression [edit]

miR-184 displays a tissue- and developmental-specific expression pattern. In mammals, mature miR-184 is particularly enriched in the brain and testis,^[7] along with the corneal epithelium.^[9] Depolarization of cortical neurons results in pri-miR-184 expression in an allele specific manner.^[7] High expression is observed in suprabasal cells of the corneal epithelium in the mouse model, along with expression in mouse testis and brain tissue.^[7]^[9] In Zebrafish, it is expressed in lens, hatching gland and epidermis (shown by Northern blot).^[10] miR-184 is expressed ubiquitously in Drosophila embryos, larvae and adults, and its expression pattern displays dynamic changes during the development of embryo, especially in the central nervous system.^[2]^[5] However, the temporal and spatial expression pattern of miR-184 is still being debated.

Role in neuronal cells [edit]

C. Liu et al. showed that Methyl-CpG binding protein 1 (MBD1) regulates the expression of several miRNAs in adult neural stem/progenitor cells (aNSCs) and, specifically, that miR-184 is directly repressed by MBD1. High levels of miR-184 promotes cell proliferation but inhibits differentiation of aNSCs, whereas inhibition of miR-184 rescued phenotypes associated with MBD1 deficiency.^[11]

Numblike (Numbl) is known to be important in embryonic neural stem cell function and cortical brain development and has been identified as a downstream target of miR-184.^[12]^[13] It has been found that exogenously expressed Numbl could rescue aNSC proliferation and differentiation deficits resulting from either elevated miR-184 or MBD1 deficiency.^[11]

Other Targets [edit]

An analysis of the primary transcript of miR-184 (pri-mir-184) in several mouse tissues revealed specific expression in the brain and testis. Its expression is repressed by the binding of methyl-CpG binding protein 2 (MeCP2) to its promoter, but is upregulated by the release of MeCP2 after depolarization, suggesting a link between miRNAs and DNA methylation pathways .^[7] J. Yu et al. demonstrated that the lipid phosphatase SH2-containing phosphoinositide 5’phosphatase 2 (SHIP2) is a target of miRNA-205 (miR-205) in epithelial cells, and that the corneal epithelial-specific miR-184 can interfere with the ability of miR-205 to suppress SHIP2 levels. The mechanism by which miR-184 negatively regulates miR-205 appears to be unique, and is the first example of a miRNA negatively regulating another to maintain levels of a target protein. miR-184 does not directly affect SHIP2 translation, but instead prevents miR-205 from interacting with SHIP2 mRNA. Interfering with miR-205 function by using a synthetic antagomir, or by the ectopic expression of miR-184, is thought to lead to a coordinated damping of the Akt signaling pathway via SHIP2 induction.^[14]

R. Weitzel et al. showed that miR-184 mediates NFAT1 translational regulation in umbilical cord blood (UCB) graft CD4+ T-cells leading to blunted allogenic responses.^[15]

Furthermore, miR-184 has multiple roles in Drosophila female germline development.^[16]

Finally, a recent study identified miR-184 as essential for embryonic corneal commitment of pluripotent stem cells.^[17]

Disease relevance [edit]

• A single base mutation in the seed region of miR-184 causes EDICT syndrome, a hereditary eye disease.^[18]

• A mutation altering the miR-184 seed region causes familial keratoconus with cataract.^[19]

• Rett syndrome.^[7]

• Several forms of cancer (see below) including elevation of miR-184 levels in squamous cell carcinoma of the tongue.^[20] All-trans-retinoic acid induces miR-184 expression in neuroblastoma cell line and ectopic miR-184 causes apoptosis.^[21]

• miR-184 has been implicated in ischemia-induced retinal neovascularization.^[22]

Angiogenesis and cancer [edit]

Dysregulation of miRNA expression is thought to play a part in abnormal gene expression in cancer cells, and miR-184 has been implicated in several forms of cancer.^[20]^[23] MYCN has been found to contribute to tumorigenesis, in part, by repressing miR-184, leading to increased levels of the serine/threonine kinase, AKT2. AKT2 is a major effector of the phosphatidylinositol 3-kinase (PI3K) pathways, one of the most potent survival pathways in cancer, and is a direct target of miR-184. It has been suggested that MYCN provides a tumourigenic effect, in part, by protecting AKT2 mRNA from degradation by miR-184, permitting the PI3K pathway to remain functional.^[24]

miR-184 has been found to be significantly increased in the tumor cells in comparison with the normal epithelial cells of the tongue. High miR-184 levels were not only detected in the tumor tissues, but also in the plasma of patients with tongue squamous cell carcinoma (SCC). Decreased plasma levels of miR-184 were observed in patients after surgical removal of the primary tumor, suggesting that it is a potential oncogenic miRNA in tongue SCC. Inhibiting miR-184 promotes apoptosis as well as hindering cell proliferation in cultured tongue SCC cells.^[25] Furthermore, over expression of miR-184 in neuroblastoma cell lines results in apoptosis.^[21]

References [edit]

^ Cullen BR (December 2004). "Transcription and processing of human microRNA precursors". Mol. Cell 16 (6): 861–5. doi:10.1016/j.molcel.2004.12.002. PMID 15610730.
^ ^a ^b Li P, Peng J, Hu J, Xu Z, Xie W, Yuan L (March 2010). "Localized expression pattern of miR-184 in Drosophila". Mol Biol Rep 38 (1): 355–8. doi:10.1007/s11033-010-0115-1. PMID 20339929.
^ Hutvágner G, Zamore PD (April 2002). "RNAi: nature abhors a double-strand". Curr. Opin. Genet. Dev. 12 (2): 225–32. doi:10.1016/S0959-437X(02)00290-3. PMID 11893497.
^ Hutvágner G, Zamore PD (September 2002). "A microRNA in a multiple-turnover RNAi enzyme complex". Science 297 (5589): 2056–60. doi:10.1126/science.1073827. PMID 12154197.
^ ^a ^b Aboobaker AA, Tomancak P, Patel N, Rubin GM, Lai EC (December 2005). "Drosophila microRNAs exhibit diverse spatial expression patterns during embryonic development". Proc. Natl. Acad. Sci. U.S.A. 102 (50): 18017–22. doi:10.1073/pnas.0508823102. PMC 1306796. PMID 16330759.
^ Weitzel RP, Lesniewski ML, Greco NJ, Laughlin MJ (October 2010). "Reduced methyl-CpG protein binding contributing to miR-184 expression in umbilical cord blood CD4(+) T-cells". Leukemia 25 (1): 169–72. doi:10.1038/leu.2010.227. PMID 20927133.
^ ^a ^b ^c ^d ^e ^f Nomura T, Kimura M, Horii T, et al. (April 2008). "MeCP2-dependent repression of an imprinted miR-184 released by depolarization". Hum. Mol. Genet. 17 (8): 1192–9. doi:10.1093/hmg/ddn011. PMID 18203756.
^ Jørgensen HF, Ben-Porath I, Bird AP (April 2004). "Mbd1 is recruited to both methylated and nonmethylated CpGs via distinct DNA binding domains". Mol. Cell. Biol. 24 (8): 3387–95. PMC 381685. PMID 15060159.
^ ^a ^b Ryan DG, Oliveira-Fernandes M, Lavker RM (2006). "MicroRNAs of the mammalian eye display distinct and overlapping tissue specificity". Mol. Vis. 12: 1175–84. PMID 17102797.
^ Wienholds E, Kloosterman WP, Miska E, et al. (July 2005). "MicroRNA expression in zebrafish embryonic development". Science 309 (5732): 310–1. doi:10.1126/science.1114519. PMID 15919954.
^ ^a ^b Liu C, Teng ZQ, Santistevan NJ, et al. (May 2010). "Epigenetic regulation of miR-184 by MBD1 governs neural stem cell proliferation and differentiation". Cell Stem Cell 6 (5): 433–44. doi:10.1016/j.stem.2010.02.017. PMID 20452318.
^ Li HS, Wang D, Shen Q, et al. (December 2003). "Inactivation of Numb and Numblike in embryonic dorsal forebrain impairs neurogenesis and disrupts cortical morphogenesis". Neuron 40 (6): 1105–18. doi:10.1016/S0896-6273(03)00755-4. PMID 14687546.
^ Petersen PH, Zou K, Hwang JK, Jan YN, Zhong W (October 2002). "Progenitor cell maintenance requires numb and numblike during mouse neurogenesis". Nature 419 (6910): 929–34. doi:10.1038/nature01124. PMID 12410312.
^ Yu J, Ryan DG, Getsios S, Oliveira-Fernandes M, Fatima A, Lavker RM (December 2008). "MicroRNA-184 antagonizes microRNA-205 to maintain SHIP2 levels in epithelia". Proc. Natl. Acad. Sci. U.S.A. 105 (49): 19300–5. doi:10.1073/pnas.0803992105. PMC 2587229. PMID 19033458.
^ Weitzel RP, Lesniewski ML, Haviernik P, et al. (June 2009). "microRNA 184 regulates expression of NFAT1 in umbilical cord blood CD4+ T cells". Blood 113 (26): 6648–57. doi:10.1182/blood-2008-09-181156. PMC 2710921. PMID 19286996.
^ Iovino N, Pane A, Gaul U (July 2009). "miR-184 has multiple roles in Drosophila female germline development". Dev. Cell 17 (1): 123–33. doi:10.1016/j.devcel.2009.06.008. PMID 19619497.
^ Shalom-Feuerstein R, Serror L, De La Forest Divonne S, Petit I, Aberdam E, Camargo L, Damour O, Vigouroux C, Solomon A, Gaggioli C, Itskovitz-Eldor J, Ahmad S, Aberdam D. Pluripotent stem cell model reveals essential roles for miR-450b-5p and miR-184 in embryonic corneal lineage specification. Stem Cells. 2012 May;30(5):898-909. doi: 10.1002/stem.1068. PubMed PMID: 22367714.
^ Iliff BW, Riazuddin SA, Gottsch JD (January 2012), "A Single-Base Substitution in the Seed Region of miR-184 Causes EDICT Syndrome", Invest. Ophthalmol. and Vis. Sci. 53 (1): 348–53, PMID doi 22131394 doi Text "10.1167/iovs.11-8783 " ignored (help)
^ Hughes AE, Bradley DT, Campbell M, Lechner J, Dash DP, Simpson DA, Willoughby CE (2011). "Mutation Altering the miR-184 Seed Region Causes Familial Keratoconus with Cataract". American Journal of Human Genetics 89 (5): 628–33. doi:10.1016/j.ajhg.2011.09.014. PMC 3213395. PMID 21996275. edit
^ ^a ^b Wong TS, Liu XB, Wong BY, Ng RW, Yuen AP, Wei WI (May 2008). "Mature miR-184 as Potential Oncogenic microRNA of Squamous Cell Carcinoma of Tongue". Clin. Cancer Res. 14 (9): 2588–92. doi:10.1158/1078-0432.CCR-07-0666. PMID 18451220.
^ ^a ^b Chen Y, Stallings RL (February 2007). "Differential patterns of microRNA expression in neuroblastoma are correlated with prognosis, differentiation, and apoptosis". Cancer Res. 67 (3): 976–83. doi:10.1158/0008-5472.CAN-06-3667. PMID 17283129.
^ Shen J, Yang X, Xie B, et al. (July 2008). "MicroRNAs regulate ocular neovascularization". Mol. Ther. 16 (7): 1208–16. doi:10.1038/mt.2008.104. PMID 18500251.
^ Hayashita Y, Osada H, Tatematsu Y, et al. (November 2005). "A polycistronic microRNA cluster, miR-17-92, is overexpressed in human lung cancers and enhances cell proliferation". Cancer Res. 65 (21): 9628–32. doi:10.1158/0008-5472.CAN-05-2352. PMID 16266980.
^ Foley NH, Bray IM, Tivnan A, et al. (2010). "MicroRNA-184 inhibits neuroblastoma cell survival through targeting the serine/threonine kinase AKT2". Mol. Cancer 9: 83. doi:10.1186/1476-4598-9-83. PMC 2864218. PMID 20409325.
^ Wong TS, Ho WK, Chan JY, Ng RW, Wei WI (2009). "Mature miR-184 and squamous cell carcinoma of the tongue". ScientificWorldJournal 9: 130–2. doi:10.1100/tsw.2009.12. PMID 19219377.

External links [edit]

Page for mir-184 microRNA precursor family at Rfam

v t e miRNA precursor families

1-100	1 2 6 7 8/141/200 9/79 10 15 16 17 19 21 22 24 26 29 30 31 33 34 46/47/281 92 96

101-200	101 103/107 122 124 126 127 129 130 132 133 134 135 137 138 143 144 145 146 148/152 150 155 156 160 166 172 181 184 191 192/215 194 196 199 200

201+	203 205 208 210 214 218 219 221 223 224 296 338 395 399 433 451

Other	BART1 BART2 BHRF1-1 BHRF1-2 BHRF1-3 Let-7 Lin-4 Lsy-6

Genome context

Coordinates (dper_r1.3_FB2010_02)	Overlapping transcripts
scaffold_2: 863164-863251 [+]	intergenic

Mature sequence dpe-miR-184-5p
Accession	MIMAT0008700
Previous IDs	dpe-miR-184*
Sequence	16 - ccuuaucauucucgcgccccg - 36 Get sequence
Evidence	by similarity; MI0000354

Mature sequence dpe-miR-184-3p
Accession	MIMAT0008701
Previous IDs	dpe-miR-184
Sequence	55 - uggacggagaacugauaagggc - 76 Get sequence
Evidence	by similarity; MI0000354

miRBase

Stem-loop sequence dpe-mir-184

Contents

Genomic location [edit]

Expression [edit]

Role in neuronal cells [edit]

Other Targets [edit]

Disease relevance [edit]

Angiogenesis and cancer [edit]

See also [edit]

References [edit]

Further reading [edit]

External links [edit]

Mature sequence dpe-miR-184-5p

Mature sequence dpe-miR-184-3p

References

References
1	PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).