Stem-loop sequence dmo-mir-1

AccessionMI0009248 (change log)
DescriptionDrosophila mojavensis miR-1 stem-loop
Gene family MIPF0000038; mir-1
Stem-loop
   ug    uuu  --ga            c        a   ---g   u 
5'   cgcc   ga    guuccaugcuuc uugcauuc aua    uau u
     ||||   ||    |||||||||||| |||||||| |||    |||  
3'   gcgg   cu    cgagguaugaag aauguaag uau    aua a
   -a    --u  aaag            a        g   acga   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dmoj_r1.3_FB2010_02) Overlapping transcripts
scaffold_6500: 24555186-24555275 [+]
intergenic
Database links

Mature sequence dmo-miR-1

Accession MIMAT0008694
Sequence

56 - 

uggaauguaaagaaguauggag

 - 77

Get sequence
Evidence by similarity; MI0000116

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).