Stem-loop sequence dmo-mir-7

AccessionMI0009246 (change log)
DescriptionDrosophila mojavensis miR-7 stem-loop
Gene family MIPF0000022; mir-7
Stem-loop
   g     uu      u       u  u     --       u   c 
5'  agugc  gccgua ggaagac ag gauuu  uguuguu ggu u
    |||||  |||||| ||||||| || |||||  ||||||| |||  
3'  uuacg  cgguau ucuucug uc cuaaa  acaauaa ucg c
   -     cu      -       u  c     ua       -   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dmoj_r1.3_FB2010_02) Overlapping transcripts
scaffold_6496: 1650045-1650131 [-]
intergenic
Database links

Mature sequence dmo-miR-7

Accession MIMAT0008692
Sequence

15 - 

uggaagacuagugauuuuguugu

 - 37

Get sequence
Evidence by similarity; MI0000127

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).