Stem-loop sequence dmo-mir-279

AccessionMI0009235 (change log)
DescriptionDrosophila mojavensis miR-279 stem-loop
Gene family MIPF0000184; mir-279
Stem-loop
   gu                    a     c  uguu     uuguu   u 
5'   acuacuguuuuuagugagug ggguc ag    ucaca     ugc u
     |||||||||||||||||||| ||||| ||    |||||     |||  
3'   ugauggcaaaaauuacucac ccuag uc    agugu     aug a
   cu                    a     a  ----     ---uu   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dmoj_r1.3_FB2010_02) Overlapping transcripts
scaffold_6540: 26447138-26447230 [+]
intergenic
Database links

Mature sequence dmo-miR-279

Accession MIMAT0008682
Sequence

60 - 

ugacuagauccacacucauuaa

 - 81

Get sequence
Evidence by similarity; MI0000363

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).