Stem-loop sequence dmo-mir-11

AccessionMI0009233 (change log)
DescriptionDrosophila mojavensis miR-11 stem-loop
Gene family MIPF0000252; mir-11
Stem-loop
     a  uaa         uuu      cc    ugaauucc 
5' gc cu   caagaacuu   cuguga  ugcg        u
   || ||   |||||||||   ||||||  ||||        a
3' cg ga   guucuugag   gacacu  acgc        u
     c  uuc         ucu      --    caaacgua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dmoj_r1.3_FB2010_02) Overlapping transcripts
scaffold_6540: 1740124-1740204 [-]
intergenic
Database links

Mature sequence dmo-miR-11

Accession MIMAT0008679
Sequence

54 - 

caucacagucugaguucuugc

 - 74

Get sequence
Evidence by similarity; MI0000131

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).