Stem-loop sequence dmo-mir-133

AccessionMI0009231 (change log)
DescriptionDrosophila mojavensis miR-133 stem-loop
Gene family MIPF0000029; mir-133
Stem-loop
   --    -     gug           cauc  gu     -  guu 
5'   caac gcugu   uaguugguuga    gg  cagau cu   u
     |||| |||||   |||||||||||    ||  ||||| ||    
3'   guug ugacg   gucgaccaacu    cc  guuua ga   u
   ua    g     -au           -ucc  ug     a  gcu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dmoj_r1.3_FB2010_02) Overlapping transcripts
scaffold_6500: 24707677-24707762 [+]
intergenic
Clustered miRNAs
< 10kb from dmo-mir-133
dmo-mir-133scaffold_6500: 24707677-24707762 [+]
dmo-mir-288scaffold_6500: 24709800-24709895 [-]
Database links

Mature sequence dmo-miR-133

Accession MIMAT0008678
Sequence

52 - 

uugguccccuucaaccagcugu

 - 73

Get sequence
Evidence by similarity; MI0000362

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).