Stem-loop sequence dmo-mir-288

AccessionMI0009228 (change log)
DescriptionDrosophila mojavensis miR-288 stem-loop
Gene family MIPF0000223; mir-288
Stem-loop
   -  a  c     -------   ua  -  -u  a      u  ug   a  a 
5'  gg cg gucgu       aau  gc ug  gc cagcgu gc  gcg ua u
    || || |||||       |||  || ||  || |||||| ||  ||| || u
3'  cc gc cagua       uua  ug ac  ug guugca ug  ugc gu a
   g  g  a     cuuuacu   gc  u  uu  -      c  gu   a  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dmoj_r1.3_FB2010_02) Overlapping transcripts
scaffold_6500: 24709800-24709895 [-]
intergenic
Clustered miRNAs
< 10kb from dmo-mir-288
dmo-mir-288scaffold_6500: 24709800-24709895 [-]
dmo-mir-133scaffold_6500: 24707677-24707762 [+]
Database links

Mature sequence dmo-miR-288

Accession MIMAT0008675
Sequence

65 - 

uuucaugucgauuucauuucaug

 - 87

Get sequence
Evidence by similarity; MI0000384

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).