Stem-loop sequence dmo-mir-6-3

AccessionMI0009226 (change log)
DescriptionDrosophila mojavensis miR-6-3 stem-loop
Gene family MIPF0000119; mir-6
Stem-loop
      g           uu      u       ucgaauu 
5' aaa agaagagaacg  cgcugu gauguag       c
   ||| |||||||||||  |||||| |||||||       a
3' uuu uuuuuucuugu  gugaca cuauauu       u
      g           cg      -       ucuaauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dmoj_r1.3_FB2010_02) Overlapping transcripts
scaffold_6496: 20935959-20936036 [-]
intergenic
Clustered miRNAs
< 10kb from dmo-mir-6-3
dmo-mir-309scaffold_6496: 20937119-20937193 [-]
dmo-mir-3scaffold_6496: 20936993-20937057 [-]
dmo-mir-286scaffold_6496: 20936787-20936889 [-]
dmo-mir-4scaffold_6496: 20936627-20936707 [-]
dmo-mir-5scaffold_6496: 20936464-20936535 [-]
dmo-mir-6-1scaffold_6496: 20936315-20936380 [-]
dmo-mir-6-2scaffold_6496: 20936137-20936217 [-]
dmo-mir-6-3scaffold_6496: 20935959-20936036 [-]
Database links

Mature sequence dmo-miR-6

Accession MIMAT0008635
Sequence

52 - 

uaucacaguggcuguucuuuuu

 - 73

Get sequence
Evidence by similarity; MI0000125

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).