Stem-loop sequence dmo-mir-13a

AccessionMI0009214 (change log)
DescriptionDrosophila mojavensis miR-13a stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
   u   u     u      -        a   uagcca 
5'  gcg aacuc ucaagg gguuguga aug      u
    ||| ||||| |||||| |||||||| |||      u
3'  ugc uugag aguuuu ccgacacu uac      a
   g   u     u      a        a   ugaacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dmoj_r1.3_FB2010_02) Overlapping transcripts
scaffold_6540: 10568354-10568427 [+]
intergenic
Clustered miRNAs
< 10kb from dmo-mir-13a
dmo-mir-2cscaffold_6540: 10568097-10568183 [+]
dmo-mir-13ascaffold_6540: 10568354-10568427 [+]
dmo-mir-13b-1scaffold_6540: 10568524-10568591 [+]
Database links

Mature sequence dmo-miR-13a

Accession MIMAT0008661
Sequence

47 - 

uaucacagccauuuugaugagu

 - 68

Get sequence
Evidence by similarity; MI0000133

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).