Stem-loop sequence dmo-mir-309

AccessionMI0009213 (change log)
DescriptionDrosophila mojavensis miR-309 stem-loop
Gene family MIPF0000140; mir-3
Stem-loop
         a gu      ug      uu   -  g uuc 
5' auuaua g  aaacuu  uucagu  ugc cg g   u
   |||||| |  ||||||  ||||||  ||| || |    
3' uaauau c  uuugaa  ggguca  acg gu u   a
         g ug      gu      cu   c  g ugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dmoj_r1.3_FB2010_02) Overlapping transcripts
scaffold_6496: 20937119-20937193 [-]
intergenic
Clustered miRNAs
< 10kb from dmo-mir-309
dmo-mir-309scaffold_6496: 20937119-20937193 [-]
dmo-mir-3scaffold_6496: 20936993-20937057 [-]
dmo-mir-286scaffold_6496: 20936787-20936889 [-]
dmo-mir-4scaffold_6496: 20936627-20936707 [-]
dmo-mir-5scaffold_6496: 20936464-20936535 [-]
dmo-mir-6-1scaffold_6496: 20936315-20936380 [-]
dmo-mir-6-2scaffold_6496: 20936137-20936217 [-]
dmo-mir-6-3scaffold_6496: 20935959-20936036 [-]
Database links

Mature sequence dmo-miR-309

Accession MIMAT0008660
Sequence

50 - 

ucacugggugaaguuugucgua

 - 71

Get sequence
Evidence by similarity; MI0000421

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).