Stem-loop sequence dmo-mir-304

AccessionMI0009210 (change log)
DescriptionDrosophila mojavensis miR-304 stem-loop
Gene family MIPF0000308; mir-304
Stem-loop
       ca    u       aau       u     c auuu    c 
5' gcag  uuga uaaucuc   uuguaaa gugag g    uuaa u
   ||||  |||| |||||||   ||||||| ||||| |    ||||  
3' cguc  agcu guuagag   aacguuu cacuc c    aguu a
       ag    c       guu       -     a --gc    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dmoj_r1.3_FB2010_02) Overlapping transcripts
scaffold_6359: 3259161-3259249 [+]
intergenic
Clustered miRNAs
< 10kb from dmo-mir-304
dmo-mir-283scaffold_6359: 3257715-3257808 [+]
dmo-mir-304scaffold_6359: 3259161-3259249 [+]
dmo-mir-12scaffold_6359: 3259787-3259860 [+]
Database links

Mature sequence dmo-miR-304

Accession MIMAT0008657
Sequence

12 - 

uaaucucaauuuguaaaugugag

 - 34

Get sequence
Evidence by similarity; MI0000411

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).