Stem-loop sequence dmo-mir-2c

AccessionMI0009205 (change log)
DescriptionDrosophila mojavensis miR-2c stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
   ua    -       -      aag     agaa      --   ug 
5'   cuuu caguguc aucaaa   ggcug    ugauau  uuc  u
     |||| ||||||| ||||||   |||||    ||||||  |||  a
3'   gaag gucacgg uaguuu   ccgac    acuaug  aag  a
   gg    c       g      cga     ----      uu   uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dmoj_r1.3_FB2010_02) Overlapping transcripts
scaffold_6540: 10568097-10568183 [+]
intergenic
Clustered miRNAs
< 10kb from dmo-mir-2c
dmo-mir-2cscaffold_6540: 10568097-10568183 [+]
dmo-mir-13ascaffold_6540: 10568354-10568427 [+]
dmo-mir-13b-1scaffold_6540: 10568524-10568591 [+]
Database links

Mature sequence dmo-miR-2c

Accession MIMAT0008652
Sequence

54 - 

uaucacagccagcuuugaugggc

 - 76

Get sequence
Evidence by similarity; MI0000431

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).