Stem-loop sequence dmo-mir-285

AccessionMI0009204 (change log)
DescriptionDrosophila mojavensis miR-285 stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
   --    auu    a     ga    u      a    uaacgccca    g 
5'   ucaa   gaag acuga  ucga uggugc uaga         aaaa u
     ||||   |||| |||||  |||| |||||| ||||         ||||  
3'   gguu   uuuc ugacu  agcu accacg aucu         uuuu c
   aa    auu    g     aa    u      -    -uaacuuua    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dmoj_r1.3_FB2010_02) Overlapping transcripts
scaffold_6680: 15475398-15475497 [+]
intergenic
Database links

Mature sequence dmo-miR-285

Accession MIMAT0008651
Sequence

67 - 

uagcaccauucgaaaucagugc

 - 88

Get sequence
Evidence by similarity; MI0000377

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).