Stem-loop sequence dmo-mir-2b

Accession MI0009203
Description Drosophila mojavensis miR-2b stem-loop
Gene family MIPF0000049; mir-2
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-2_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-2 microRNA family includes the microRNA genes mir-2 and mir-13 (MIPF0000049). Mir-2 is widespread in invertebrates, and it is the largest family of microRNAs in the model species Drosophila melanogaster. MicroRNAs from this family are produced from the 3' arm of the precursor hairpin. Leaman et al. showed that the miR-2 family regulates cell survival by translational repression of proapoptotic factors. Based on computational prediction of targets, a role in neural development and maintenance has been suggested.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
       a          -         a   --uuu  uu 
uuguguc uucuucaaag ugguuguga aug     gc  u
||||||| |||||||||| ||||||||| |||     ||  u
agcacag gaggaguuuc accgacacu uac     cg  u
       c          g         a   ucauc  uc 
Get sequence
Genome context
Coordinates (dmoj_r1.3_FB2010_02) Overlapping transcripts
scaffold_6500: 6907819-6907900 [+]
intergenic
Clustered miRNAs
< 10kb from dmo-mir-2b
dmo-mir-2b scaffold_6500: 6907819-6907900 [+]
dmo-mir-2a-1 scaffold_6500: 6908323-6908400 [+]
dmo-mir-2a-2 scaffold_6500: 6908911-6908982 [+]

Mature sequence dmo-miR-2b

Accession MIMAT0008650
Sequence

53 - 

uaucacagccagcuuugaggagc

 - 75

Get sequence
Evidence by similarity; MI0000120

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).