Stem-loop sequence dmo-mir-281-1

AccessionMI0009195 (change log)
DescriptionDrosophila mojavensis miR-281-1 stem-loop
Gene family MIPF0000087; mir-46
Stem-loop
         aguga           -ug     c      ---c    a 
5' cgaaua     auaaagagagc   uccgu gacagu    cagu a
   ||||||     |||||||||||   ||||| ||||||    ||||  
3' gcuuau     uguuucucucg   aggua cuguca    guua a
         -agua           uua     -      aaau    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dmoj_r1.3_FB2010_02) Overlapping transcripts
scaffold_6496: 6376234-6376321 [-]
intergenic
Clustered miRNAs
< 10kb from dmo-mir-281-1
dmo-mir-281-1scaffold_6496: 6376234-6376321 [-]
dmo-mir-281-2scaffold_6496: 6376069-6376161 [-]
Database links

Mature sequence dmo-miR-281-1-5p

Accession MIMAT0008641
Previous IDsdmo-miR-281-1*
Sequence

15 - 

aagagagcuguccgucgacagu

 - 36

Get sequence
Evidence by similarity; MI0000366

Mature sequence dmo-miR-281-3p

Accession MIMAT0008642
Previous IDsdmo-miR-281
Sequence

56 - 

ugucauggaauugcucucuuugu

 - 78

Get sequence
Evidence by similarity; MI0000370

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).