Stem-loop sequence dmo-mir-283

AccessionMI0009194 (change log)
DescriptionDrosophila mojavensis miR-283 stem-loop
Gene family MIPF0000054; mir-216
Stem-loop
   cc     uc       a           u         agcaaugcc 
5'   gauuc  aaaggua auaucagcugg aauucuggg         c
     |||||  ||||||| ||||||||||| |||||||||         a
3'   uuaag  uuuucau uaugguugacu uuaaggcuc         a
   --     uu       a           -         acaaaguau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dmoj_r1.3_FB2010_02) Overlapping transcripts
scaffold_6359: 3257715-3257808 [+]
intergenic
Clustered miRNAs
< 10kb from dmo-mir-283
dmo-mir-283scaffold_6359: 3257715-3257808 [+]
dmo-mir-304scaffold_6359: 3259161-3259249 [+]
dmo-mir-12scaffold_6359: 3259787-3259860 [+]
Database links

Mature sequence dmo-miR-283

Accession MIMAT0008640
Sequence

15 - 

uaaauaucagcugguaauucu

 - 35

Get sequence
Evidence by similarity; MI0000368

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).