Stem-loop sequence dmo-mir-31b

AccessionMI0009193 (change log)
DescriptionDrosophila mojavensis miR-31b stem-loop
Gene family MIPF0000064; mir-31
Stem-loop
        -    aau     a     uc  a       agagcacaaauaucauagaauccagaa 
5' caaau aaug   uuggc agaug  gg auagcug                           u
   ||||| ||||   ||||| |||||  || |||||||                           u
3' guuua uuac   aacug ucuac  cc uaucggc                           u
        c    guu     a     -u  g       gacaugaguuauuuuauguguuuuaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dmoj_r1.3_FB2010_02) Overlapping transcripts
scaffold_6473: 5711151-5711277 [+]
intergenic
Database links

Mature sequence dmo-miR-31b

Accession MIMAT0008639
Sequence

14 - 

uggcaagaugucggaauagcug

 - 35

Get sequence
Evidence by similarity; MI0000410

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).