Stem-loop sequence dmo-mir-219

AccessionMI0009192 (change log)
DescriptionDrosophila mojavensis miR-219 stem-loop
Gene family MIPF0000044; mir-219
Stem-loop
   ua    -g     u   ua    u     aac          uug   u 
5'   auuc  auuuu agc  ugau gucca   gcaauucuug   auu u
     ||||  ||||| |||  |||| |||||   ||||||||||   |||  
3'   uaag  uaaag ucg  gcua cgggu   cguugggaac   uaa u
   cc    ag     c   gc    -     cua          uca   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dmoj_r1.3_FB2010_02) Overlapping transcripts
scaffold_6680: 4316909-4317006 [-]
intergenic
Database links

Mature sequence dmo-miR-219

Accession MIMAT0008638
Sequence

19 - 

ugauuguccaaacgcaauucuug

 - 41

Get sequence
Evidence by similarity; MI0000358

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).