Stem-loop sequence dmo-mir-13b-2

AccessionMI0009190 (change log)
DescriptionDrosophila mojavensis miR-13b-2 stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
   uu  g       u  a      gcuauguu     g 
5'   gc cgucaaa ug cuguga        uauga a
     || ||||||| || ||||||        ||||| u
3'   ug gcaguuu ac gacacu        auacu u
   uu  a       u  c      --------     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dmoj_r1.3_FB2010_02) Overlapping transcripts
scaffold_6473: 13342566-13342632 [-]
intergenic
Database links

Mature sequence dmo-miR-13b

Accession MIMAT0008636
Sequence

44 - 

uaucacagccauuuugacgagu

 - 65

Get sequence
Evidence by similarity; MI0000134

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).