Stem-loop sequence dmo-bantam

AccessionMI0009188 (change log)
DescriptionDrosophila mojavensis bantam stem-loop
Gene family MIPF0000153; bantam
Stem-loop
   au     uac    c          uu      g   -  uuu 
5'   uugac   gaaa cgguuuucga  ugguuu acu gu   u
     |||||   |||| ||||||||||  |||||| ||| ||    
3'   aacug   uuuu gucgaaaguu  acuaga uga ca   u
   --     ---    a          uu      g   a  uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dmoj_r1.3_FB2010_02) Overlapping transcripts
scaffold_6680: 4143311-4143392 [+]
intergenic
Database links

Mature sequence dmo-bantam

Accession MIMAT0008634
Sequence

53 - 

ugagaucauuuugaaagcugauu

 - 75

Get sequence
Evidence by similarity; MI0000387

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).