Stem-loop sequence dmo-mir-12

AccessionMI0009184 (change log)
DescriptionDrosophila mojavensis miR-12 stem-loop
Gene family MIPF0000181; mir-12
Stem-loop
         ug     u    c          -  gccaa 
5' uacggu  aguau acau agguacuggu gu     u
   ||||||  ||||| |||| |||||||||| ||      
3' gugccg  ucaua ugua uucaugacca ca     u
         ca     c    -          a  aucaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dmoj_r1.3_FB2010_02) Overlapping transcripts
scaffold_6359: 3259787-3259860 [+]
intergenic
Clustered miRNAs
< 10kb from dmo-mir-12
dmo-mir-283scaffold_6359: 3257715-3257808 [+]
dmo-mir-304scaffold_6359: 3259161-3259249 [+]
dmo-mir-12scaffold_6359: 3259787-3259860 [+]
Database links

Mature sequence dmo-miR-12

Accession MIMAT0008630
Sequence

7 - 

ugaguauuacaucagguacuggu

 - 29

Get sequence
Evidence by similarity; MI0000132

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).