Stem-loop sequence dmo-mir-316

AccessionMI0009181 (change log)
DescriptionDrosophila mojavensis miR-316 stem-loop
Gene family MIPF0000254; mir-316
Stem-loop
   a     -    c   u           g   -a   a    uua 
5'  aguuc uagu gau ugucuuuuucc cuu  cug cguu   u
    ||||| |||| ||| ||||||||||| |||  ||| ||||   u
3'  uuaag auca uua gcggaaaaagg gaa  gac gcaa   g
   -     u    u   u           -   gg   g    caa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dmoj_r1.3_FB2010_02) Overlapping transcripts
scaffold_6680: 18891209-18891295 [+]
intergenic
Database links

Mature sequence dmo-miR-316

Accession MIMAT0008627
Sequence

16 - 

ugucuuuuuccgcuuacugacg

 - 37

Get sequence
Evidence by similarity; MI0000428

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).