Stem-loop sequence dgr-mir-2c

AccessionMI0009180 (change log)
DescriptionDrosophila grimshawi miR-2c stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
   ca    uua    -       -      aag     a  -     a  ucu 
5'   uguc   cuuu caauguc aucaaa   ggcug ga augau ua   g
     ||||   |||| ||||||| ||||||   ||||| || ||||| ||    
3'   acgg   gaaa guuacgg uaguuu   ccgac cu ugcua gu   c
   --    ---    c       g      cga     a  a     a  uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dgri_r1.3_FB2010_02) Overlapping transcripts
scaffold_14906: 4357884-4357979 [-]
intergenic
Clustered miRNAs
< 10kb from dgr-mir-2c
dgr-mir-2cscaffold_14906: 4357884-4357979 [-]
dgr-mir-13ascaffold_14906: 4357687-4357760 [-]
dgr-mir-13b-1scaffold_14906: 4357504-4357571 [-]
Database links

Mature sequence dgr-miR-2c

Accession MIMAT0008626
Sequence

61 - 

uaucacagccagcuuugaugggc

 - 83

Get sequence
Evidence by similarity; MI0000431

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).